Department of Biotechnology, Sant Gadge Baba Amravati UniversityAmravati-444 602, Maharashtra India
*For Correspondence - mkrai123@rediffmail.com
Online published on 18 October, 2011.
Identification and differentiation of Bacillus thuringiensis from B. cereus which causes food poisoning and B. anthracis, a causal agent of anthrax is not easy. The three Bacilli species share a great number of phenotypic and biochemical characteristics therefore, their authentic identification remains a problem. In the present study, we have applied newly developed methodology of the species-specific primer designing and use of polymerase chain reaction for identification and differentiation among commercial B. thuringiensis from B. cereus and B. anthracis. We have designed species-specific primers successfully by comparing different cry sequence using the primer designing tool Ampliconb 09. The forward primer was found to be ccactacttacagccgtag whereas, the reverse primer was agttgatatgcgtctaggtggt there was no self complementarities and Hairpin shown by the primers. By using this set of primers it is easy to differentiate B. thuringiensis from B. anthracis and B. cereus. However, results need to be confirmed by wet lab techniques.
Bacillus thuringiensis, Ampliconb09, cry sequences
(216.73.217.64)