1Department of Medical Laboratory Techniques, College of Health and Medical Technology
2Department of Medical Laboratory Techniques, Medical Technical Institute, Medical Technical University, Baghdad, Iraq
*Corresponding Author: Yousor M. Jameel, Department of Medical Laboratory Techniques, Medical Technical Institute, Medical Technical University, Baghdad, Iraq, Email: yousor.alazzawi@gmail.com
Online published on 23 December, 2019.
Pediculus humanus capitis is one of the ectoparasites which lead to transition of Typhus fever. Rickettsial infections which affect the vasculature cause nonspecific signs and symptoms making it difficult to diagnose the disease clinically. This study was performed to investigate the genetic sequence of these external parasites and the possibility of their development that may make them more dangerous to transfer many pathogens to the human body.
In this study, 200 patients of school students (65 males and 135 females) with their ages ≥18 years were enrolled. In addition, 8(4%) of them were infected with rickettsiosis. All the patients were tested for detection of IGM and IgG anti-Rickettsia antibodies by ELISA and IFA techniques.
The serum titers for Anti-Rickettsia Antibodies (IgG) were 1/128, 1/256 and 1/512 among 8 of them as 2(25%), 4(50%) and 2(25%), respectively. The COI gene was detected with 552bp. The primers used F-AGCTCATTTGTTCAAGGCGG and R TACCAACACCCTCCAGCAAA with sequence size 827.
There was a 100 percent similarity between USA strains and Iraqi strains of the Bene Bank, indicating that the lice have not been developed.
Pediculus humanus capitis, Typhus fever, Gene sequence, Antibody titer, ectoparasite
