P.03. An analysis of the partial nucleotide sequence of RT region of Citrus yellow mosaic virus (CYMV) genome and sequence variability with other badnaviruses
Author:
T.M. Venkata Prasanna1, Anthony Johnson1, S. Raja Subramanyam2, Indranil Dasgupta2, D.V.R. Sai Gopal1
Total Page Count: 1
DOI:
Page Number: 48 to 48
1Department of Virology, S. V. University, Tirupati-517502, A.P.
2Department of Plant Molecular Biology, University of Delhi South campus, New Delhi.
Abstract
A viral DNA was isolated and purified from total nucleic acid extract of sweet orange (Citrus sinensis (L. Osb.) CYMV-T infected leaves. Primers pair forward 51 CCATCGATCGATTCTTGACACAGGAG 31 and reverse 51 GCTCTAGAA CTAGGATGTCGTCGATG 31 were designed to Reverse Transcriptase region of ORF III poly protein. Samples were amplified for 30 cycles using DNA thermal cycler (Perkin - Elimer Cetus). The amplified DNA eluted and PCR product was ligated with pBSK+ vector. Competent E.Coli (strain XL 1 blue) were transferred and clones were identified by restriction endonucleases (Cla I and Xba I) and selected clones were sequenced. The sequenced amplicon was 1072 base pairs. Sequences were searched in BLAST analysis and compared the sequences with other badnaviruses. CYMV-T sequence of RT region was analysed and compared with other reported badnaviruses like CYMV (95%), CSSV (65.65%), CoYMV (63.38%) KTSV (64.22%) BSV (65.11%) ScBV (64.06%), TBV (62.16%), DBV (61.32%) and RTBV (57.64%), a former member in badnavirus group. Phylogenetic relationships were estimated by using CLUSTAL X programme. The genetic distance and pair-wise distance values were estimated by using the progamme DNADIST and Kimura 2-parameter method. Phylogentic tree was constructed based on sequence data with the original data set by using a DNA-parsimony (DNAPARS) method. By the above sequence analysis it is concluded that the RT region of CYMV-T isolate is closely related to reported badnaviruses.
