1Advanced Center for Plant Virology, Division of Plant Pathology, Indian Agricultural Institute, New Delhi-110012.
2Department of Plant Pathology, Tamil Nadu Agricultural University, Coimbatore-641003.
Abstracts of Research Papers Presented during the National Symposium of Indian Virological Society at Unit of Plant Virology, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi-110 012, October 14–1.
Papaya ringspot virus (PRSV) is a major limiting factor affecting the cultivation of papaya in India. In the 60's and early 70's it was a constraint in parts of western and northern India. By the mid 80's it also spread to Andhra Pradesh and Karnataka, where papaya cultivation was taken on a large scale. Recently, the virus has also been observed in Tamil Nadu. The papaya orchard of Tamil Nadu Agricultural University (TNAU), Coimbatore was completely free of PRSV till 2003, but in 2004 some plants of papaya var. CO7 were found severely affected by the virus. Virus affected papaya plants of var. CO-7 developed mosaic, leaf blistering and leaf filiformy, which are typical symptoms of PRSV infection.
Flexuous particles were found associated with all the symptomatic papaya samples, which were confirmed to be those of PRSV by immuno-electron microscopy using polyclonal antiserum to PRSV (Delhi isolate). The identity of the virus was further confirmed by reverse transcription polymerase chain reaction and coat protein (CP) sequence analysis. The CP gene was amplified and sequenced (GenBank Accession No. AY687386) using specific primers HRP52 (5‘TCCAA(A/G)AATGAAGCTGTGGATGT3) and RKJ3 (5‘GTTGCGCATACCCAGGAGAG3‘). The CP gene was 285 amino acids long and the conserved regions common to the genus Potyvirus, such as WCIEN and QMKAA, were present. Like all known PRSV sequences, a stretch of glutamic acid and lysine repeats (EK region) was also present after the aphid transmission motif (DAG).
Comparative CP sequence analysis revealed that the Coimbatore isolate shared 90–98% amino acid sequence identity with PRSV isolates originating from other locations in India. The sequence identity was 96% with the isolate originating from Andhra Pradesh and 95–98% with the Karnataka isolates, while it was 90–92% with the isolates from central, eastern and northern India. Thus the isolates from southern India formed a distinct group. The Coimbatore isolate, however, had only 91% sequence identity with the Sri Lankan isolate, indicating difference in the origin of isolates in southern India and Sri Lanka. These findings suggest that the spread of the PRSV to Coimbatore has taken place from the adjoining areas of Karnataka state. Occurrence of the virus in other areas of Tamil Nadu needs to be monitored.
