Central Institute for Cotton Research, Post Box No: 2, Shankar Nagar (PO), Nagpur-440010, India.
Abstracts of the papers presented at the International Conference of Indian Virological Society on “Emerging and Re-emerging viral Diseases of the Tropics and Subtropics” at Indian Agricultural Research Institute, New Delhi, India, December 11–14, 2007.
Cotton leaf curl disease (CLCuD) is caused by a Gemini virus DNA- A and DNA-ß, transmitted by whitefly Bemisia tabaci vector, which is ravaging the cotton crop in Northern region of India. This is a serious problem in the northern region and leads to yield losses up to 58% and 69% (ICAC recorder, 1999). Severe epidemics of plant disease caused by Gemini viruses have emerged in recent years. Genetic transformation of cotton leafcurl virus susceptible genotypes H777, HS 6, F 846 was carried via Agrobacterium-mediation. Three Agrobacterium tumefaciens gene constructs (EHA 105) each carrying a binary vector pBin AR with antisense coat protein AV1 (750 bp) gene, sense coat protein (750 bp) gene, antisense Rep gene AC1(540 bp) driven by 35 S CaMV promoter along with the nptII gene as a selection marker was used for cocultivation with the embryonic axes. Transformed shoots were grown on MS selection media containing kanamycin 50 μg/ml. Putative transformants were subcultured on shoot elongation medium containing BAP and kinetin 1mg/l and rooting medium containing IBA 1mg/l along with kanamycin. Genomic DNA was isolated from putative transformants of the three genotypes viz., H 777, F846 and HS 6 and subjected for molecular confirmation by PCR. The npt-II positive genomic DNA were further confirmed for the presence of the respective forward and reverse primers for Sence CPF-5’ AATTATGTCGA AGCGAGCTGC-3’, R-5’ TATAGTTAAGCAATGTCTCAG3’, AntisenceCP F-5’TTAATACAGCTTCGCTCGACG 3’, R-5’ ATATCAATTCGTTACA GAGTC and AntisenceRep gene F-5’ ATGCCACGTGATTTAAAAACA-3’, R-5’ GTGGGGAGAGTTTCAGATCG-3’. The PCR positive genomic DNA was subjected to restriction digestion with Eco RI and Bam HI enzymes for Southern blotting experiments. The restricted DNA was transferred to nitro cellulose membrane for further analysis by non-radioactive/radio active method to verify the integration of the T-DNA with AV 1 and AC 1 gene. The To plants were raised in the sterile vermiculite pots and then transferred to the pots with soil.
