Indian Journal of Virology
  • Year: 2009
  • Volume: 20
  • Issue: 1

P-74. Primer designing against apple chlorotic leaf spot virus infecting apples in Himachal Pradesh

  • Author:
  • Reena Kumari, S.V Bhardwaj, Monisha Katoch
  • Total Page Count: 1
  • Page Number: 46 to 46

Department of Biotechnology, Dr Y.S. Parmar University of Horticulture & Forestry, Nauni- Solan-173 230, India.

Abstracts of the papers presented at the XVIII National Conference of Indian Virological Society at Post Graduate Institute of Medical Education and Research, Chandigarh, India, December 11–13, 2008.

Abstract

Apple chlorotic leaf spot virus (ACLSV) belonging to genus trichovirus of family flexiviridae is one of the most widely distributed plant virus,causes great looses to both yield and fruit quality of apple production worldwide. During these investigations, serological indexing through DAS-ELISA confirmed the presence of ACLSV in the samples drawn from the pathology field of Dr Y.S. Parmar UHF, Nauni, Solan and orchards of Habban. After assuring the presence of virus by serological indexing, primers were designed against CP gene of ACLSV using different bioinformatics softwares viz: Exome Horizon, Web Primer, Primer 3, Gene Fisher and Primer Blast. Efficacies of the designed primers were tested using RT PCR. Three best primer pair was selected on the basis of important parameters like length, melting temperature, GC% and secondary structures. Sequences of Primer pair1 (5′ AAGGTAGACGCAGATTTGAAGG 3′ Forward primer; 5′ CACTCCATTAATACCACGACTC 3′ Reverse primer), Primer pair 2 (5′ TCAGTTAAAGGTGGACGCAGA 3′ Forward primer; 5′ CATGGGTTCAAGAGTTTGACG 3′ Reverse primer) and Primer pair 3 (5′ GATCAGAAGGA GGAGGATGG 3′ Forward primer; 5′ TGGGTTCAAGA-GTGGGATTC 3′ Reverse primer). Out of total RNA isolated, ACLSV CP gene mRNA was converted in cDNA using CP gene specific primers and further PCR results gave an amplicon of ~800bp by primer pair 1 and 600bp by primer pair 2. However, primer pair 3 showed band near 400bp. Results of RT-PCR confirmed that the primers designed against ACLSV could amplify the 3′ terminal region of ACLSV genome and was also inferred that the properties chosen for designing primers were ideal.