Detection of Mungbean Yellow Mosaic India Virus in Kharif Pulses and Some Weeds

Three pulse crops (mungbean, urdbean and pigeon pea) and three weeds (Acalypha indica, Croton bonplantianum and Clerodendron sp.) showing characteristic symptoms of yellow mosaic disease were screened to detect the Mungbean yellow mosaic India virus through PCR using virus specific primers, namely AC2-F- AGCTAATGACCCCTAAATTAT/AC2-RGAGTACTTGGATGAAGAGAAC; AC3-F-TTATGATTCGATA TTGAATTAATTA/AC3-R-CTGAAGTGTGGGTGTAGCTAT and AC4-F-CAAATTACAATTTAAGTTATG/AC4-RACTTCTAGCCTTGTCAACACCAG. All the primers pairs viz., AC2-F/AC2-R, AC3-F/AC3-R and AC4-F/AC4-R amplified the targeted DNA fragments, ~480 bp, ~450 bp and ~500 bp, respectively only from diseased samples of mungbean, urdbean and pigeon pea. Samples from weeds showing yellow mosaic gave negative results. This indicated that the yellow mosaic disease in these weeds was caused by some other viruses and they are not host of MYM IV and do not have any role in the epidemiology of the MYMIV in kharif pulses at Kanpur.