INTERNATIONAL JOURNAL OF MEDICAL TOXICOLOGY & LEGAL MEDICINE
  • Year: 2020
  • Volume: 23
  • Issue: 3and4

Case study of wildlife forensic via an integrated bioinformatics software, geneious

  • Author:
  • S. Venkataramanan1*, Danniya M. Lakshmi1, Zainah Abdul Sattar1, Nur Afiqah Zainalabidin1, Nur Azznira Azman1
  • Total Page Count: 4
  • Page Number: 49 to 52

1Faculty of Health and Life Sciences, Management and Science University, Seksyei 13, 40100, Shah Alam, Selangor, Malaysia

*Corresponding Author S. Venkataraman, Senior Lecturer Faculty of Health and Life Sciences, Management & Science University, 40100Shah Alam, Selangor, Malaysia. Email: svenkataramanan@msu.edu.mv

Online published on 15 February, 2021.

Abstract

Background: Bioinformatics is a field that enfolds all kinds of sciences involving forensic sciences. The invention of Bioinformatics-based tools takes over the forensic sciences and research over time. Aim: This project aims to analyze the unknown bear bile DNA sequence to determine the origin of the sample from a wildlife forensic case using an interactive bioinformatics software. Methods: In order to make multiple copies of the selected DNA of the mitochondrial cytochrome B gene, the two generic primers used were H15149: TAAACTGCAGCCCCTCAGAATGATATTTGTC & L14841.

AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA. Each chromatogram was respectively edited to remove several regions that ambiguous. Both chromatogram sequences were assembled via de novo method. Upon having the assembled consensus bear bile sequence, BLAST function was used to detect several hits to find similar sequences from NCBI database. Lastly, phylogenetic tree was built by doing multiple sequence alignment to find the genetic match of the consensus bear bile sequence. Results and discussion: The consensus bear bile had been matched with 100 hits, indicating that it is closely related to Ursus thibetanus. According to the phylogenetic tree with 9 descendants, the closest descendants with the existing sequence was Selenarctos thibetanus, which is also another name of Ursus thibetanus. Via identifying the closest related species, the forensic community may move on in their next investigation part. Conclusion: In conclusion, forensic research adapted the computation method for the identification of DNA with the assistance of bioinformatics. The closest related species of consensus bear bile was obtained through GENEIOUS. This project explores the current state of bioinformatic methods and tool that used for the wildlife trading and other DNA analysis procedure currently most widely used.

Keywords

DNA forensic, Wildlife, GENEIOUS, Bioinformatics, Ursus thibetanus